View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1900_low_44 (Length: 203)
Name: NF1900_low_44
Description: NF1900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1900_low_44 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 55643367 - 55643164
Alignment:
| Q |
1 |
gtaaagattaaaaacatgttgttcaacataaactctatcacaaaaacgatcatatgaatgacatttatcataccaaatgaaaatgttacctttacccaa- |
99 |
Q |
| |
|
||||| ||||||| ||| ||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55643367 |
gtaaaaattaaaatcattttgtttaacatgaactctatcacaaaaacgatcataagaatgacatttatcataccaaataaaaatgttacctttacccacg |
55643268 |
T |
|
| Q |
100 |
tgcgtaatgaatcttgtaatgagaatattagctactttgactatgaactaggaatattggctgcctttaactatagatcaccaagaatatgagttctctt |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55643267 |
tgcgtaatgaatcttataatgagaatattagctactttgactatgaactttgaatattagctgcctttaactatagatcaccaagaatatgagttctctt |
55643168 |
T |
|
| Q |
200 |
gacc |
203 |
Q |
| |
|
|||| |
|
|
| T |
55643167 |
gacc |
55643164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University