View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_high_22 (Length: 257)
Name: NF19012_high_22
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 35364470 - 35364703
Alignment:
| Q |
13 |
atatactcattggagccattcatgatttgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgatttt |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364470 |
atatactcattggagccattcaagatttgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgatttt |
35364569 |
T |
 |
| Q |
113 |
ggcacaagtttgcaagaggtgtgcataatttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgttcaccaataatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364570 |
ggcacaagtttgcaagaggtgtgcataatttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgttcaccaataatt |
35364669 |
T |
 |
| Q |
213 |
cgttgtaagttagaaaataattacgaaacccttt |
246 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
35364670 |
cgttgtaagttagaaaataattatgaaacccttt |
35364703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 35376234 - 35376422
Alignment:
| Q |
13 |
atatactcattggagccattcatgatttgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgatttt |
112 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||| ||||||||||||| |||||||||||||||||||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
35376234 |
atatactcattggagccagtcaagatctgttgcactatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctcgatttt |
35376333 |
T |
 |
| Q |
113 |
ggcacaagtttgcaagaggtgtgcataatttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgtt |
201 |
Q |
| |
|
|||||||||||| ||| |||||||||| | |||||||||||| ||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35376334 |
ggcacaagtttgaaaggggtgtgcatagtccaatcccattgtaagggccttgtccacaacaagctatctttgatgtaacaaatcctgtt |
35376422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 40 - 201
Target Start/End: Original strand, 35357706 - 35357867
Alignment:
| Q |
40 |
tgttggactatgattctgcaagctttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcacaagtttgcaagaggtgtgcata |
139 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| | || ||||||||||||||| |||| ||||||| ||||||| |||| || |||||| || | |
|
|
| T |
35357706 |
tgttggactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcataaaggtttcgatttgggcacaattttgaaataggtgtacaca |
35357805 |
T |
 |
| Q |
140 |
atttaatcccattgtatgggccatactcacaacaagctttctttgatgtaacaaatcctgtt |
201 |
Q |
| |
|
| |||||| ||| || | || | |||||||||| | ||||| |||||||||||||||| |
|
|
| T |
35357806 |
gtccaatcccgttgaatcgcccttgaccacaacaagcatcctttgctgtaacaaatcctgtt |
35357867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University