View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_high_24 (Length: 253)
Name: NF19012_high_24
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 40788492 - 40788386
Alignment:
| Q |
7 |
ccaccaccatcatcaatgtctaaggttcaataactcgttttcttatctacttctttcatttcacactcgcgcatatcaaatttcatccatgtcgcagaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40788492 |
ccaccaccatcatcaatgtctaaggttcaataactcgttttcttatcttcttctttcatttcacactcgcgcatatcaaatttcatccatgtcgcagaag |
40788393 |
T |
 |
| Q |
107 |
aaaaaga |
113 |
Q |
| |
|
||||||| |
|
|
| T |
40788392 |
aaaaaga |
40788386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University