View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19012_high_25 (Length: 237)

Name: NF19012_high_25
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19012_high_25
NF19012_high_25
[»] chr8 (1 HSPs)
chr8 (52-222)||(32483051-32483221)
[»] chr3 (1 HSPs)
chr3 (165-222)||(52767556-52767613)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 52 - 222
Target Start/End: Complemental strand, 32483221 - 32483051
Alignment:
52 tgcatcacattcatataatagtacctgtatgaaaattacgagttaaaacaagagcatttgaaccatctctagggcgtttagaaatatctctttgtaaagg 151  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
32483221 tgcatcacattcatataatagtacctgtatgaaaattacgagttgaaacaagagcatttgaaccatctctagggcgtttagaaatatctctttgtaatgg 32483122  T
152 agaagaagataactgttgttgacgttcacggcgtctagaagcaggaacccaagtgcttttaacatgagttt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32483121 agaagaagataactgttgttgacgttcacggcgtctagaagcaggaacccaagtgcttttaacatgagttt 32483051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 52767556 - 52767613
Alignment:
165 tgttgttgacgttcacggcgtctagaagcaggaacccaagtgcttttaacatgagttt 222  Q
    |||||||| |||||||||||| ||| ||| ||||||||||| || |||||||| ||||    
52767556 tgttgttgtcgttcacggcgtttagcagcgggaacccaagtactcttaacatgtgttt 52767613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University