View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_high_3 (Length: 451)
Name: NF19012_high_3
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_high_3 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 203 - 451
Target Start/End: Complemental strand, 32483534 - 32483286
Alignment:
| Q |
203 |
gctgatagatatgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtc |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483534 |
gctgatagatatgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtc |
32483435 |
T |
 |
| Q |
303 |
atcagtatttggctatctttttcagagaattcctctaaaccaaaagattctctctttgtttttgctttcctttatttcaccactcactctcttaaccata |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483434 |
atcagtatttggctatctttttcagagaattcctctaaaccaaaagattctctctttgtatttgctttcctttatttcaccactcactctcttaaccata |
32483335 |
T |
 |
| Q |
403 |
acactgaaaagggtcaatcacggaaactgctagtgcttctgattaatac |
451 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483334 |
acactgaaaagggtcaatcacggaaactgctagtgcttctgattaatac |
32483286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 10 - 143
Target Start/End: Complemental strand, 32483735 - 32483602
Alignment:
| Q |
10 |
aagaaaatgatggtagctagtgattgaggtgagaatatgtgtggatgtgaaagagagagggaatgtgctaagaaagaggaggaaaaacagtttctttctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483735 |
aagaaaatgatggtagctagtgattgaggtgagaatatgtgtggatgtgaaagagagagggaatgtgctaagaaagaggaggaaaaacagtttctttctt |
32483636 |
T |
 |
| Q |
110 |
ggtcagggctactaaataacagtgatgtttttca |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32483635 |
ggtcagggctactaaataacagtgatgtttttca |
32483602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University