View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_high_30 (Length: 228)
Name: NF19012_high_30
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 93 - 209
Target Start/End: Complemental strand, 28079430 - 28079314
Alignment:
| Q |
93 |
ggcaaatgctggatatgaaactgatttattttttctgtttatagtaaagctttggannnnnnnaatcacttttacactgttttcagcttaaggttaagaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28079430 |
ggcaaatgctggatatgaaactgatttattttttctgtttatagtaaagctttggatttttttaatcacttttacactgttttcagcttaaggttaagaa |
28079331 |
T |
 |
| Q |
193 |
ttattttaagtaaggta |
209 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28079330 |
ttattttaagtaaggta |
28079314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 28079523 - 28079488
Alignment:
| Q |
1 |
tttgattttggtatgtcaaaaacaagtgtaactatg |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28079523 |
tttgattttggtatgtcaaaaacaagtgtaactatg |
28079488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University