View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_high_32 (Length: 218)
Name: NF19012_high_32
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 42073573 - 42073782
Alignment:
| Q |
1 |
gaagctcatgagagtagagattctgctataattgaagtttctgagatgagatcttcatttggtgagctgaaacaaaagctagagtatttggaaggttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42073573 |
gaagctcatgagagtagagattctgctataattgaagtttctgagatgagatcttcatttggtgagctgaaacaaaagcttgagtatttggaaggttact |
42073672 |
T |
 |
| Q |
101 |
gtgaagagttgaagaaagcgttgaaacaagcaatgcaagcaaaagaatctccactttgtgatgagaaacttggaataccatttgatggaaatggagaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42073673 |
gtgaagagttgaagaaagcgttgaaacaagcaatgcaagcaaaagaatctccactttgtgatgagaaacttggaataccatttgatggaaatggagaaaa |
42073772 |
T |
 |
| Q |
201 |
tttgatgatg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
42073773 |
tttgatgatg |
42073782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 125
Target Start/End: Original strand, 24876566 - 24876657
Alignment:
| Q |
34 |
gaagtttctgagatgagatcttcatttggtgagctgaaacaaaagctagagtatttggaaggttactgtgaagagttgaagaaagcgttgaa |
125 |
Q |
| |
|
||||||||||||||| ||| |||||| || ||| ||| ||| ||| | ||||| ||||| ||||||||||||| |||||||||| ||||| |
|
|
| T |
24876566 |
gaagtttctgagatgcgatgttcattgggagagttgagacagaagatggagtacttggagaattactgtgaagagctgaagaaagctttgaa |
24876657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University