View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_high_4 (Length: 440)
Name: NF19012_high_4
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 7e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 7e-96
Query Start/End: Original strand, 253 - 434
Target Start/End: Original strand, 40788093 - 40788274
Alignment:
| Q |
253 |
gttgatgaatataatttaggaatgagagaaaaagtagcaaccttcgaaaccttggatgaatttgacgattttggaagaacaaccttcacaatgcatgtcg |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40788093 |
gttgatgaatataatttaggaatgagagaaaaagtagcaaccttcgaaaccttggatgaatttgacgattttggaagaacaaccttcacaatgcatgtcg |
40788192 |
T |
|
| Q |
353 |
accttcaaaatgacgttagttggtttcgtttcattctttttattattctcgttcttcttattgttgttgttattgatgatgt |
434 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40788193 |
accttcaaaatgacgttagttggtttcgtttcattatttttattattctcgttcttcttattgttgttgttattgatgatgt |
40788274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 37 - 192
Target Start/End: Original strand, 40787878 - 40788033
Alignment:
| Q |
37 |
ggaaccggagaaatgaagtcaactttcttcttcgttttaatagcaaggttatctctgagttttccagcatcgacggttccggtgacggttaactttccgc |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787878 |
ggaaccggagaaatgaagtcaactttcttcttcgttttaatagtaaggttatctctgagttttccagcatcgacggttccggtgacggttaactttccgc |
40787977 |
T |
|
| Q |
137 |
cattaccaatatcaagtttttcgaagccttcaataagaaggttcaatgcttcagtt |
192 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787978 |
cattaccaatatcaagtttctcgaagccttcaataagaaggttcaatgcttcagtt |
40788033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University