View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_low_15 (Length: 333)
Name: NF19012_low_15
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 31612777 - 31612459
Alignment:
| Q |
1 |
atattgttttggcattcttacactgaaatgagaatggatgatagttaatattacatggttctagttttttaattttggtttatgaattacaatatcacca |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
31612777 |
atattgttttggcattcttacattgaaatgagaatggatgatagttaatattacatgcttctagttttttaattttggtttatgaattacaaaatcacaa |
31612678 |
T |
 |
| Q |
101 |
aaatgattatcggcttcacaacaagttgcctctacatttcacggtcctgtctaaaaagttatacaaaccagactatcaaccaaaatatctctaagataaa |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| || ||||||| ||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
31612677 |
aaatgattatcggcttcacgacaagttgcctctacatttcacggtattgcctaaaaaattatacaaatcagactatcaaccaaaatatctctaaaataaa |
31612578 |
T |
 |
| Q |
201 |
acaactcatttcagtgtacgattggatcagttttcaaagataaatgcagaagctgagcatatgtcaaaggtttcttatgccggttttattggttgtttaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31612577 |
acaactcatttcagtgtacgattggatcagtcttcaatgacaaatgcagaagctgagcatatgtcaaaggtttcttatgctggttttattggttgtttaa |
31612478 |
T |
 |
| Q |
301 |
tgtataatatgatcttcat |
319 |
Q |
| |
|
||||| ||||||| ||||| |
|
|
| T |
31612477 |
tgtatgatatgattttcat |
31612459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 221 - 305
Target Start/End: Complemental strand, 31611535 - 31611451
Alignment:
| Q |
221 |
attggatcagttttcaaagataaatgcagaagctgagcatatgtcaaaggtttcttatgccggttttattggttgtttaatgtat |
305 |
Q |
| |
|
||||||| |||||||||||| ||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
31611535 |
attggattagttttcaaagacaaatgcagaagtagagcatatgtcaaaggttccttatgccagttttattggttgtttaatgtat |
31611451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 31607219 - 31607131
Alignment:
| Q |
1 |
atattgttttggcattcttacactgaaatgagaatggatgatagttaatattacatggttctagttttttaattttggtttatgaatta |
89 |
Q |
| |
|
|||| ||||||||||| ||||| |||||| |||| |||||||||||||||||||||| | |||||| ||| |||||||||||||||||| |
|
|
| T |
31607219 |
atatggttttggcatttttacattgaaataagaacggatgatagttaatattacatgctactagttgttttattttggtttatgaatta |
31607131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 188 - 223
Target Start/End: Complemental strand, 31607017 - 31606982
Alignment:
| Q |
188 |
tctctaagataaaacaactcatttcagtgtacgatt |
223 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31607017 |
tctctaagataaaacaacccatttcagtgtacgatt |
31606982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 221 - 305
Target Start/End: Complemental strand, 33559704 - 33559620
Alignment:
| Q |
221 |
attggatcagttttcaaagataaatgcagaagctgagcatatgtcaaaggtttcttatgccggttttattggttgtttaatgtat |
305 |
Q |
| |
|
||||||| ||| | |||||||| ||||||||| | || |||||||||||||| |||||| | || ||||||||||||| |||||| |
|
|
| T |
33559704 |
attggattagtgtccaaagatagatgcagaagttaagtatatgtcaaaggttccttatgtcagtgttattggttgtttgatgtat |
33559620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University