View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_low_22 (Length: 259)
Name: NF19012_low_22
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 243
Target Start/End: Complemental strand, 34872490 - 34872256
Alignment:
| Q |
9 |
aatatggaggtagaggcgagcaactctctcaaggggaatagggtggagcctgttgacaaagggaagaatgtgcccgtcaaagttgtgcctcttcggtctg |
108 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34872490 |
aatatggaggtagaggtgagcaactctctcaaggggaatagggtggagcctgttgacaaagggaagaatgtgcccgtcaaagttgtgcctcttcagtctc |
34872391 |
T |
|
| Q |
109 |
agggagaggatctgctccagctgttgaacgtgcggtccgatcctgatcgatatggcccccactcgaccatttgccgcagtgatctaaagctgaaggttat |
208 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872390 |
agggagaggatttgctccaactgttgaacgtgtggtccgatcctgatcgatatggcccccactcgaccatttgccgcagtgatctaaagctgaaggttat |
34872291 |
T |
|
| Q |
209 |
tcaagacctgggaaccgctggccggggtaaaactg |
243 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| |
|
|
| T |
34872290 |
tcaagacctgggaaccgctggccggagcaaaactg |
34872256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University