View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_low_26 (Length: 237)
Name: NF19012_low_26
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 52 - 222
Target Start/End: Complemental strand, 32483221 - 32483051
Alignment:
| Q |
52 |
tgcatcacattcatataatagtacctgtatgaaaattacgagttaaaacaagagcatttgaaccatctctagggcgtttagaaatatctctttgtaaagg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32483221 |
tgcatcacattcatataatagtacctgtatgaaaattacgagttgaaacaagagcatttgaaccatctctagggcgtttagaaatatctctttgtaatgg |
32483122 |
T |
|
| Q |
152 |
agaagaagataactgttgttgacgttcacggcgtctagaagcaggaacccaagtgcttttaacatgagttt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483121 |
agaagaagataactgttgttgacgttcacggcgtctagaagcaggaacccaagtgcttttaacatgagttt |
32483051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 165 - 222
Target Start/End: Original strand, 52767556 - 52767613
Alignment:
| Q |
165 |
tgttgttgacgttcacggcgtctagaagcaggaacccaagtgcttttaacatgagttt |
222 |
Q |
| |
|
|||||||| |||||||||||| ||| ||| ||||||||||| || |||||||| |||| |
|
|
| T |
52767556 |
tgttgttgtcgttcacggcgtttagcagcgggaacccaagtactcttaacatgtgttt |
52767613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University