View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19012_low_30 (Length: 229)

Name: NF19012_low_30
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19012_low_30
NF19012_low_30
[»] chr2 (1 HSPs)
chr2 (7-229)||(17142518-17142740)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 17142518 - 17142740
Alignment:
7 aaaatgaaggatgattatcatacttggacccctttaggggtctatttataaccatcaaatttgattgtattatgctttgctatatcatatagatcatatt 106  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17142518 aaaatgaaggatgattatcatacatggacccctttaggggtctatttataaccatcaaatttgattgtattatgctttgctatatcatatagatcatatt 17142617  T
107 aaacatggtgcataaaacatgtcattgacataagtatttttgtaatgccaattgggatacctcaagtggttaagaattagggagctagtactccccttct 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||    
17142618 aaacatggtgcataaaacatgtcattgacataagtatttttgtaatgccaattgggctacctcaagtggttaagaattagggagctagtactcctcttct 17142717  T
207 ttaagggtggggtattgatccca 229  Q
    |||||||||||||||||||||||    
17142718 ttaagggtggggtattgatccca 17142740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University