View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19012_low_30 (Length: 229)
Name: NF19012_low_30
Description: NF19012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19012_low_30 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 17142518 - 17142740
Alignment:
| Q |
7 |
aaaatgaaggatgattatcatacttggacccctttaggggtctatttataaccatcaaatttgattgtattatgctttgctatatcatatagatcatatt |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17142518 |
aaaatgaaggatgattatcatacatggacccctttaggggtctatttataaccatcaaatttgattgtattatgctttgctatatcatatagatcatatt |
17142617 |
T |
 |
| Q |
107 |
aaacatggtgcataaaacatgtcattgacataagtatttttgtaatgccaattgggatacctcaagtggttaagaattagggagctagtactccccttct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17142618 |
aaacatggtgcataaaacatgtcattgacataagtatttttgtaatgccaattgggctacctcaagtggttaagaattagggagctagtactcctcttct |
17142717 |
T |
 |
| Q |
207 |
ttaagggtggggtattgatccca |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17142718 |
ttaagggtggggtattgatccca |
17142740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University