View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19013_high_23 (Length: 237)
Name: NF19013_high_23
Description: NF19013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19013_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 223
Target Start/End: Complemental strand, 40719921 - 40719701
Alignment:
| Q |
4 |
ttatcactttgtttatgaacaaaaa-gaaatgaaaatagtaattaaagactattaacaaaatggtcgttgcttttagcattatttaacaacagtccaaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40719921 |
ttatcactttgtttatgaacaaaaaagaaaacaaaatagtaattaaagactattaacaaaatggtcgttgcttttagcattatttaacaacagtccaaaa |
40719822 |
T |
 |
| Q |
103 |
taagtgatggtctaattgatgtttcttttaagttgatgataaagaattgaaacatgcatcttttgatgtttataagatgcttcgttgatactatatgtgg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40719821 |
taagtgatggtctaattgatgtttcttttaagttgatgataaagaattgaaacatgcatcttttgatgtttataagatgcttcgttgatactatatgtgg |
40719722 |
T |
 |
| Q |
203 |
tcaaaatacatcacctctttg |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40719721 |
tcaaaatacatcacctctttg |
40719701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University