View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19013_low_18 (Length: 247)
Name: NF19013_low_18
Description: NF19013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19013_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 45293024 - 45293271
Alignment:
| Q |
1 |
aataaagggacatgatcataaaaggatgcctctattgcagtttgctgagtttggattgcagaaagttgggtttagattcatgatgggaggtggtaataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45293024 |
aataaagggacatgatcataaaaggatgcctctattgcagtttgctgagtttggattgcagaaagttgggtttagattcatgatgggaggtggtaataat |
45293123 |
T |
|
| Q |
101 |
gagcaatcaatggatagtacttctgaggctaacaattcagatagcagtgagtgtgaagtggaagttgttagtttggtaatctcttattctccttaactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
45293124 |
gagcaatcaatggatagtacttctgaggctaacaattcagatagcagtgagtgtgaagtggaagttgttagtttggtaatctcttattatccttaattct |
45293223 |
T |
|
| Q |
201 |
ttatgtaaa-ttataggcaaaatacatcttgcggtatttcaagttatt |
247 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45293224 |
gtatgtaaatttataggcaaaatacatcttgcggtatttcaagttatt |
45293271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University