View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19013_low_28 (Length: 223)
Name: NF19013_low_28
Description: NF19013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19013_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 39663928 - 39663719
Alignment:
| Q |
1 |
tgcacaagagaatgaggttggattcctagtgatcgagatgccaaagagttttgagataattggtaatttctagctgcttctctttcccttttgtgtgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663928 |
tgcacaagagaatgaggttggattcctagtgatcgagatgccaaagagttttgagataattggtaatttctagctgcttctctttcccttttgtgtgcat |
39663829 |
T |
 |
| Q |
101 |
tttggtgaccccctaaggcttgtgaattgaaaaactttctcatgcagaagttgcatgagtatgtctttttgttgtgaagaggtttgcatgaatatgtctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39663828 |
tttggtgaccccctaaggcttgtgaattgtaaaactttctcatgcagaagttgcatgagtatgtctttttgttgtgaagaggtttgcatgaatatgtctt |
39663729 |
T |
 |
| Q |
201 |
tttgttgtga |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
39663728 |
tttgttgtga |
39663719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 39663745 - 39663711
Alignment:
| Q |
151 |
ttgcatgagtatgtctttttgttgtgaagaggttt |
185 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
39663745 |
ttgcatgaatatgtctttttgttgtgaagaggttt |
39663711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 91 - 128
Target Start/End: Original strand, 31519976 - 31520013
Alignment:
| Q |
91 |
ttgtgtgcattttggtgaccccctaaggcttgtgaatt |
128 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31519976 |
ttgtgtgcattttggtgtcctcctaaggcttgtgaatt |
31520013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University