View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19014_high_6 (Length: 242)
Name: NF19014_high_6
Description: NF19014
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19014_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 46306298 - 46306111
Alignment:
| Q |
18 |
attattgcttgataggtccctgacacataatagtgagtcgaatatgtttattaatattcagcatacagtgaaacttatcagtctagatatatgatttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46306298 |
attattgcttgataggtccctgacacataatagtgagtcgaatatgtttattaatattcagcatacagtgaaacttatcagtctagatatatgatttcat |
46306199 |
T |
 |
| Q |
118 |
gaacttacaatgtatcaagattaatgatatgacccaactcgactggtatattccctttgaagttatttgcagaaaggttcctgtagat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46306198 |
gaacttacaatgtatcaagattaatgatatgacccaactcgactggtatattccctttgaagttatttgcagaaaggttcctgtagat |
46306111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University