View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19015_high_5 (Length: 272)
Name: NF19015_high_5
Description: NF19015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19015_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 2 - 253
Target Start/End: Complemental strand, 40805518 - 40805268
Alignment:
| Q |
2 |
catcacaagttttatctaatggaatttgaattcaactgattaagcannnnnnnnnnnnnnnnnnnatgccaaggtagttaaaactttaaagggtctcata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40805518 |
catcacaagttttatctaatggaatttgaattcaactgattaagcattttcttttcttttcttttatgccaaggtagttaaaactttaaagggtctcata |
40805419 |
T |
 |
| Q |
102 |
aataaacccnnnnnnnnnnnnnatgtgcatgttgaatctctttcagtctcttagttcaagtgttcttgttttgaaattatgtgcatgcatgtatgtgtac |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40805418 |
aataaacc-ttttttttttgttatgtgcatgttgaatctctttcagtctcttagttcaagtgttcttgttttgaaattatgtgcatgcatgtatgtgtac |
40805320 |
T |
 |
| Q |
202 |
actcttttgaatttcttgcttatttttccactttatgctaatgaattgtatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40805319 |
actcttttgaatttcttgcttatttttctactttatgctaatgaattgtatg |
40805268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University