View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19015_high_7 (Length: 204)
Name: NF19015_high_7
Description: NF19015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19015_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 39779650 - 39779476
Alignment:
| Q |
18 |
caaatatatacaacatattcattattaaccatctaatctgtgttcgcatatagatggtttttcagttgtccaagatatttattaaccacaatttgtgttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39779650 |
caaatatatacaacatattcattattaaccatctaatctgtgttcgcatatagatggtttttcagttgttcaagatatttattaaccacaatttgtgttc |
39779551 |
T |
|
| Q |
118 |
gaaaatcgtggttaagcatgatggttaatgagttaaacaacttgttatactcattaatcgtctactgagtataat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
39779550 |
aaaaatcgtggttaagcatgatggttaatgagttaaacaccttgttatactcattaatcgtctactgaatataat |
39779476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University