View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19016_high_11 (Length: 351)
Name: NF19016_high_11
Description: NF19016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19016_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 12 - 330
Target Start/End: Complemental strand, 53704979 - 53704661
Alignment:
| Q |
12 |
ataattctcaatgaaacccctcagattcgtctttttaatcccttaacatgtgtcactctttttcttcctcctattcacactttccctaatgtggtaagct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53704979 |
ataattctcaatgaaacccctcagattcgtctttttaatcccttaacatgtgtcactctttttcttcctcctattcacactttccctaacgtggtaagct |
53704880 |
T |
 |
| Q |
112 |
ttgattattcaaatatcggtcgtgagtattcggttacaaacgatagttatttaagattttttagtttgagacaaatgtgtgatgatttcatagctaaaat |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704879 |
ttgattattcaaatatcggccgtgagtattcggttacaaacgatagttatttaagattttttagtttgagacaaatgtgtgatgatttcatagctaaaat |
53704780 |
T |
 |
| Q |
212 |
tgtattttcaacaagcccttcgcttagcgatgaattcgttgcacttgctattgttgatgtttatagttgtaataatctggctttctgtaaaaaaggttat |
311 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53704779 |
tgtattgtcaacaagcccttcgcttagcgatgaattcgttgcacttgctattgttgatggttatagttgtaataatctggctttctgtaaaaaaggttat |
53704680 |
T |
 |
| Q |
312 |
gattcttggattttcctaa |
330 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53704679 |
gattcttggattttcctaa |
53704661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University