View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19016_low_17 (Length: 255)
Name: NF19016_low_17
Description: NF19016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19016_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 24 - 239
Target Start/End: Original strand, 20003193 - 20003407
Alignment:
| Q |
24 |
gcaacaatatgtatggtcccatttaaggttcccttatagttgtgtttctcttcactagtgcagatattctgtatcgacatgcaaaagataaagaaaaaac |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
20003193 |
gcaacaatatgtatggtcccatttaatgttcccttatagttgtgtttctcttcacttgtgcagatattctgtatcaacatgcaaaagataaaaaaaaaaa |
20003292 |
T |
|
| Q |
124 |
aaacacaggcactttttattagaaagaatatgcatattcgcactcgattgcaataatactatacgtttcatgttatgtggtcaaattgcataaagttgaa |
223 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20003293 |
aaa-acaggcactttttattagaaagaatatgcatattcgcactcgattgcaataatactatacgtttcatgttatgtggtcaaattgcataaagttgaa |
20003391 |
T |
|
| Q |
224 |
gatacctggtatatgg |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20003392 |
gatacctggtatatgg |
20003407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University