View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19016_low_25 (Length: 203)
Name: NF19016_low_25
Description: NF19016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19016_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 26839589 - 26839759
Alignment:
| Q |
15 |
agagagaatacatattatcataataaaaagagcgagacaaatggatacgaaatgtcattataaaggcttgtatttataatgaaactaagggagagagtat |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||| || |||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26839589 |
agagaggatacatattatcataataaaaa-agtgagacaaacggatacgaaatgtcattataaaagcttgtatttataatgaaactaagggagagagtat |
26839687 |
T |
 |
| Q |
115 |
tatcaatatcttattctgagaatgacagaggaaaaggtctatgaataattactttatagttggagttttaat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26839688 |
tatcaatatcttattctgagaatgacagaggaaaaggtctatgaataattactttatagttggagttttaat |
26839759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University