View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19017_high_14 (Length: 352)
Name: NF19017_high_14
Description: NF19017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19017_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 344
Target Start/End: Complemental strand, 49726886 - 49726560
Alignment:
| Q |
18 |
agttgttgctgttgcatccgaaaacagttacgtaatattccaaacgagatgaaaccaaaggtgtattgaccgtgaacatggaatcatatgttagaatatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
49726886 |
agttgttgctgttgcatccgaaaacagttacgtaatattccaaacgagatgaaaccaaaggtgtgttgaccatgaacattgaatcatatgttagaatatc |
49726787 |
T |
|
| Q |
118 |
acagcttttttgtagcaaaatatcgtggagttggtcgtctttgattgtgattgtgaatggttcgattttcagaatatcgaaccatcttttgttgttttgt |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49726786 |
acagcttttttgtagcaaaagatcgtggagttggtcgtctttgattgtgattgtgaatggttcgattttcagaatatcgaaccatcttttgttgttttgt |
49726687 |
T |
|
| Q |
218 |
attgnnnnnnnggattgtggttcatagtcttcacaaccatgtattactaacatgccacaatctggatgttgtgtgcttgtaaaagggaattcaatttctc |
317 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49726686 |
attgtttttttggattgtggttcatagtcttcacaaccatgtattactaacatgccacaatctggatgttgtgtgcttgtaaaagggaattcaatttctc |
49726587 |
T |
|
| Q |
318 |
cgagaaatccacaggtaattgatgatg |
344 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
49726586 |
cgagaaatccacaggtaattgaagatg |
49726560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University