View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19017_high_20 (Length: 259)
Name: NF19017_high_20
Description: NF19017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19017_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 95 - 243
Target Start/End: Original strand, 27806321 - 27806469
Alignment:
| Q |
95 |
cagagatttcttgttggatgtggactggtgagagacaatcaacaaagatgagaattaagtatcttgaagcagctttggatcaagatattcaattctttga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27806321 |
cagagatttcttgttggatgtggactggtgagagacaatcaacaaagatgagaattaagtatcttgaagctgctttggatcaagatattcaattctttga |
27806420 |
T |
|
| Q |
195 |
taccgaagttcgaacttccgatgttgttttcgctattaacagtgatgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27806421 |
taccgaagttcgaacttccgatgttgttttcgctattaacagtgatgct |
27806469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 95 - 243
Target Start/End: Complemental strand, 41179378 - 41179230
Alignment:
| Q |
95 |
cagagatttcttgttggatgtggactggtgagagacaatcaacaaagatgagaattaagtatcttgaagcagctttggatcaagatattcaattctttga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||| |||||||| || |||||||| ||||| || ||| | ||||||||| |||||||||| |
|
|
| T |
41179378 |
cagagatttcttgttggatgtggactggagagcgacaatcaaccaagatgaggatcaagtatctggaagctgcattgaaacaagatattgaattctttga |
41179279 |
T |
|
| Q |
195 |
taccgaagttcgaacttccgatgttgttttcgctattaacagtgatgct |
243 |
Q |
| |
|
||||| ||||||||||| ||||||||||| || || |||| ||||||| |
|
|
| T |
41179278 |
caccgaggttcgaacttcggatgttgtttttgcaatcaacactgatgct |
41179230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University