View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19017_high_9 (Length: 411)
Name: NF19017_high_9
Description: NF19017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19017_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 22 - 404
Target Start/End: Complemental strand, 42341222 - 42340840
Alignment:
| Q |
22 |
agaccaaacttgttccacagttttcctgcagagaggagcaggaatcgataacgaattttggcgaggaagacttgcctgtttgctaatccctttctgagct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341222 |
agaccaaacttgttccacagttttcctgcagagaggagcaggaatcgataacgaattttggcgaggaagacttgcctgtttgctaatccctttctgagct |
42341123 |
T |
|
| Q |
122 |
gcagacaagttattgttgttgctgttattattgttggatgcagcttgttgttggttttcttctgcattccaaatactacttagaaactcatccatgttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341122 |
gcagacaagttattgttgttgctgttattattgttggatgcagcttgttgttggttttcttctgcattccaaatactacttagaaactcatccatgttca |
42341023 |
T |
|
| Q |
222 |
tggatccgaaattcttgccgctatcacagaggctgtgttggaactcgtcaagggtgagtgagtatatggatgacgattgccttccgagcgatgaagaaat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42341022 |
tggatccgaaattcttgccgctatcacagaggctgtgttggaactcgtcgagggtgagtgagtatatggatgaagattgccttccgagcgatgaagaaat |
42340923 |
T |
|
| Q |
322 |
gacattgttgacgtcattcctggtcgcttcttctccttccctctgcaatgattctacctccccttgttgccaattcatctcac |
404 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340922 |
gacattgttgacgtcattcctgatcgcttcttctccttccctttgcaatgattctacctccccttgttgccaattcatctcac |
42340840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University