View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19017_low_11 (Length: 378)
Name: NF19017_low_11
Description: NF19017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19017_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4514034 - 4514272
Alignment:
| Q |
1 |
agctcaggtagttgacgacgaagaaggcggtgttctcttcatccccggcgcttc---------------ttcttcttccggatatggctacgctagcatc |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4514034 |
agctcaggtagttgacgacgaagaaggcggtgttctcttcatccccggcgcttcttctttttcttcttcttcttcttccggatatggctacgctagcatc |
4514133 |
T |
|
| Q |
86 |
gataaacaacgccaacgattacctgtttacaagtaccgtaacgccattctctacttggttgaaactcactccaccactatcatcgtcggcgaaacaggta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4514134 |
gataaacaacgccaacgattacctgtttacaagtaccgtaacgccattctctacttggttgaaactcactccaccactatcatcgtcggcgaaacaggta |
4514233 |
T |
|
| Q |
186 |
gcggcaaaaccactcaaatccctcaggtactattactaa |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4514234 |
gcggcaaaaccactcaaatccctcaggtactattactaa |
4514272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 289 - 362
Target Start/End: Original strand, 4514337 - 4514410
Alignment:
| Q |
289 |
cattgcattgcagtatctgattgaggctggttgggctgctggtggacgactcattgcttgtactcaaccgagac |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4514337 |
cattgcattgcagtatctgattgaggctggttgggcttctggtggacgactcattgcttgtactcaaccgagac |
4514410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University