View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19017_low_18 (Length: 288)
Name: NF19017_low_18
Description: NF19017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19017_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 8 - 272
Target Start/End: Complemental strand, 34881300 - 34881035
Alignment:
| Q |
8 |
gagatgaatagg-atactaaagccagtcattcaaaggttgaaaactcaatatgtcttgcaggtcagtgttgactacctaacaaagcctcttgatattttc |
106 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881300 |
gagatgaatagggatactgaagccagtcattcaaaggttgaaaactcaatatgtcttgcaggtcagtgttgactacctaacaaagcctcttgatattttc |
34881201 |
T |
 |
| Q |
107 |
aaggagatgagtaggatactcaagccaggtggattggccataatgaggtgacaatcttgtcagctatcatttctgtaaaatctaataattgaaagaaaat |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881200 |
aaggagatgaataggatactcaagccaggtggattggccataatgaggtgacaatcttgtcagctatcatttctgtaaaatctaataattgaaagaaaat |
34881101 |
T |
 |
| Q |
207 |
tttcatgaagcactttcctacaaaattgtcacttgcttagatattcaatcatgttcatctattatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34881100 |
tttcatgaagcactttcctacaaaattgtcacttgcttagatattcaatcatgttcatctattatt |
34881035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University