View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19018_low_10 (Length: 242)
Name: NF19018_low_10
Description: NF19018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19018_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 53555137 - 53554913
Alignment:
| Q |
18 |
attgtagctagctctctaaaccctcatagattctagctagctctaaacattccataaagaaagagagagagaaactacgagctctctaaatatatatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
53555137 |
attgtagctagctctctaaaccctaatatattctagctagctctaaacattccataaagaaagagagagaaaaactactagttctctaaatatatatttt |
53555038 |
T |
 |
| Q |
118 |
tataggtactaactctctaaacttgttagtattatcataattaatcgatagaaaatatctttttgaggccttggagtattcgggcttgattgtacaataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53555037 |
tataggtactaactctctaaacttgttagtattatcataattaatcgatacaaaatatctttttgaggccttggagcattcgggcttgattgtacaataa |
53554938 |
T |
 |
| Q |
218 |
tgtagctaagagaatataaaaatat |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53554937 |
tgtagctaagagaatataaaaatat |
53554913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University