View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19018_low_4 (Length: 396)
Name: NF19018_low_4
Description: NF19018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19018_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 133 - 340
Target Start/End: Original strand, 25412392 - 25412594
Alignment:
| Q |
133 |
actctaactttcatgtcgattttatcatattataataggtggaaaatatacaattatcctaaattttatgactcgattatcttgaattattgcaggtgga |
232 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25412392 |
actctaacttttatgtcgattttatcatataataataggtggaaaatatacaattatcctaaattttatgactcgat-atcttgaattattgcaggtgga |
25412490 |
T |
|
| Q |
233 |
tttgcatgtaaattaaataaacccaattgggccttgggatcatattagaccaattcatgatcgaa-tttgtacccgcatgcataaccatggacgaaactt |
331 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
25412491 |
tttgcatgtaaat-----atacccaattgggccttgggatcatattagaccaattcatgatcgaagtttgtaccagcatgcataaccatggacgaaactt |
25412585 |
T |
|
| Q |
332 |
ttttaccag |
340 |
Q |
| |
|
||||||||| |
|
|
| T |
25412586 |
ttttaccag |
25412594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 18 - 124
Target Start/End: Original strand, 25412320 - 25412426
Alignment:
| Q |
18 |
aagatcttgtatttacgtttcgtattttatgatttctagttaaaatggatttacgtttcgtatcttatgatgactctaacttttatgtcgattttatcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25412320 |
aagatcttgtatttacgtttcgtattttatgatttctagttaaaatggatttacgtttcgtatcttatgatgactctaacttttatgtcgattttatcat |
25412419 |
T |
|
| Q |
118 |
ataataa |
124 |
Q |
| |
|
||||||| |
|
|
| T |
25412420 |
ataataa |
25412426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University