View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19019_low_7 (Length: 339)
Name: NF19019_low_7
Description: NF19019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19019_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 19 - 328
Target Start/End: Complemental strand, 31936199 - 31935890
Alignment:
| Q |
19 |
aaaccagacctcggaacaaccggttttgaactcaaaaaaggaaatacacaaaccttccaagcaccagccggttggtcaggtagattctgggcaagaaccg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936199 |
aaaccagacctcggaacaaccggttttgaactcaaaaaaggaaatacacaaaccttccaagcactagccggttggtcaggtagattctgggcaagaaccg |
31936100 |
T |
 |
| Q |
119 |
gttgcaaattcgacgattctggtcacggaacttgctcaaccggtgactgtggttccggagaaattaactgcaacggtaacggtgcaacaccaccggcaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31936099 |
gttgcaaattcgacgattctggtcacggaacttgctcaaccggtgactgtggttccggagaaattaactgcaatggtaacggtgcaacaccaccggcaac |
31936000 |
T |
 |
| Q |
219 |
attagcagaattcactctaggaaatagttcgccagattactatgacgttagtctcgtagacggttacaatcttccggtgatggttgaaactagtggcggt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31935999 |
attagcagaattcactctaggaaatagttcgccagattactatgacgttagtctcgtagacggttacaatcttccggtgatggttgaaactagtggcggt |
31935900 |
T |
 |
| Q |
319 |
tcaggttcat |
328 |
Q |
| |
|
|||||||||| |
|
|
| T |
31935899 |
tcaggttcat |
31935890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 6e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 69 - 158
Target Start/End: Original strand, 8810255 - 8810344
Alignment:
| Q |
69 |
aaccttccaagcaccagccggttggtcaggtagattctgggcaagaaccggttgcaaattcgacgattctggtcacggaacttgctcaac |
158 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| ||||||||| ||| ||||||| || || || ||||||||||||||||| |
|
|
| T |
8810255 |
aaccttccaagcaccaaccggatggtcaggtagattctggggaagaaccggctgccaattcgatgactccggccacggaacttgctcaac |
8810344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 252 - 306
Target Start/End: Complemental strand, 27975686 - 27975632
Alignment:
| Q |
252 |
agattactatgacgttagtctcgtagacggttacaatcttccggtgatggttgaa |
306 |
Q |
| |
|
||||| ||| ||||| |||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
27975686 |
agatttctacgacgtgagtctcgtcgacggttacaatcttccgatgatagttgaa |
27975632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University