View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1901_high_12 (Length: 264)
Name: NF1901_high_12
Description: NF1901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1901_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 16 - 182
Target Start/End: Original strand, 9481744 - 9481907
Alignment:
| Q |
16 |
agtgtgactcgtgtaactaatatgttgtctttaaataa-ttattgtctaatgaagtagttgttttcatctattataagtttgagagaaagatgtaacata |
114 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
9481744 |
agtgtgacttttgtaactaatatgttgtctttaaataaattattgtctaatgtagtagtt----tgatctattataagtttgagagaaagatgtaacata |
9481839 |
T |
 |
| Q |
115 |
attaaaaacttattggtaacttagttaatacgtttggaaacctgaaatgggtttttataaaaagtgac |
182 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9481840 |
tttaaaaatttattggtaacttagttaatacatttggaaacctgaaatgggtttttataaaaagtgac |
9481907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 192 - 248
Target Start/End: Original strand, 9485013 - 9485069
Alignment:
| Q |
192 |
aactttttaagactgcaattaaactatgcagtacatattccaaaacatgcatatttt |
248 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
9485013 |
aactttttaagactgcaattaaaccatgcagtacttattccaaaacatgcatatttt |
9485069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University