View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1901_high_13 (Length: 249)
Name: NF1901_high_13
Description: NF1901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1901_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 29481305 - 29481069
Alignment:
| Q |
1 |
cattatattaattcaatctttcaaattattattggtgtcaatgtcgtgtttcatggatgttagtgtggactgtggttgctttataggtcaaagcagcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29481305 |
cattatattaattcaatctttcaaattattattggtgtcaatgtcgtgtttcatggatgttagtgtggactgtggttgctttataggtcaaagcagcttc |
29481206 |
T |
|
| Q |
101 |
aattgcagccgtgtgttttgtttttacaacatagaaatcactatataatgcctcaggttgtggttgtagaactttattcaaaaccttagaactagtaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29481205 |
aattgcagccgtgtgttttgtttttacaacatagaaattgctatataatggctcaggttgtggttgtagaactttattcaaaaccttagaactagtaaag |
29481106 |
T |
|
| Q |
201 |
atctcatgcaagtgcaagattgctcaggtttgatatt |
237 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29481105 |
atctcgtgcaagtgcaagattgctcaggtttgatatt |
29481069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 167 - 223
Target Start/End: Complemental strand, 29480699 - 29480643
Alignment:
| Q |
167 |
tagaactttattcaaaaccttagaactagtaaagatctcatgcaagtgcaagattgc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||| |
|
|
| T |
29480699 |
tagaactttattcaaaaccttagaactagtaaagatctcgtccaagtgcaaaattgc |
29480643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 112
Target Start/End: Complemental strand, 29480792 - 29480724
Alignment:
| Q |
37 |
gtcaatgtcgtgtttcatggatgttagtgtggactgtggttgctttataggtcaaagcagcttcaattgcagccgt |
112 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29480792 |
gtcaatgtcgtgtttgatggatgttagtgtgag-------tgcttcataggtcaaagcagcttcaattgcagccgt |
29480724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University