View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1901_high_15 (Length: 241)
Name: NF1901_high_15
Description: NF1901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1901_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 29481522 - 29481730
Alignment:
| Q |
16 |
aatatcaaggatgacaaacaaaactacccttaaattccaactcaccgagattaacttggcgattatcggccatcataggcttaacaagcatctgcacctc |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29481522 |
aatatcaaggatcacaaacaaaactaccattaaattccaactcaccgagattaacttggcgattatcggccatcataggcttaacaagcatctgcacctc |
29481621 |
T |
 |
| Q |
116 |
ccacttcttaagcggctcaccaagtatctcctctctactcaccccttcttcaggaaacttcccaaccggaaacggccccggcatttcaactttcttaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29481622 |
ccacttcttaagcggctcaccaagtatctcctctctactcaccccttcttcaggaaacttcccaaccggaaacggccccggcatttcaactttcttgaca |
29481721 |
T |
 |
| Q |
216 |
cctttcatc |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
29481722 |
cctttcatc |
29481730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University