View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1901_low_25 (Length: 237)
Name: NF1901_low_25
Description: NF1901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1901_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 10005452 - 10005233
Alignment:
| Q |
1 |
tctgattatcacatttcatactcacgggctccaattttccattccttaactcgcatagaagttgctgcaaccaaataagctcacatgtagcaagattcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10005452 |
tctgattatcacatttcatactcacgggctccaattttcaattccttaactcgcatagaagttgctgcaaccaaataagctcacatgtagcaagattcct |
10005353 |
T |
|
| Q |
101 |
agcttgatagtttgcctaatggataaagcaacaatatcctgcttctcgcactttaagaaaagtaagattcccccatctttggggcatctcacccattaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10005352 |
agcttgatagtttgcctaatggataaagcaataatatcctgcttctcgcactttaagaaaagtaagattcccccatctttggggcatctcacccattaga |
10005253 |
T |
|
| Q |
201 |
ggtttattgtggatcattgt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
10005252 |
ggtttattgtggatcattgt |
10005233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University