View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1901_low_26 (Length: 213)

Name: NF1901_low_26
Description: NF1901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1901_low_26
NF1901_low_26
[»] chr1 (2 HSPs)
chr1 (134-194)||(30905251-30905311)
chr1 (23-82)||(30905311-30905368)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 134 - 194
Target Start/End: Complemental strand, 30905311 - 30905251
Alignment:
134 acacaagtattaatttaagaaaatagtactatcatatattgaatgtaagtgtagcgtaggc 194  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||    
30905311 acacaagtattaatttaagaaaatagtactaccatatattgaatgtaagtgtagcataggc 30905251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 23 - 82
Target Start/End: Complemental strand, 30905368 - 30905311
Alignment:
23 taagatatcaaagtataatatatatttcgttaattagataaacatttaaaacctttgcca 82  Q
    |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||    
30905368 taagatatcaaagtataatatat--ttcgttaattagataaacatttaaaacctttgcca 30905311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University