View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1901_low_9 (Length: 392)
Name: NF1901_low_9
Description: NF1901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1901_low_9 |
 | |
|
| [»] scaffold0154 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0154 (Bit Score: 339; Significance: 0; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 15 - 392
Target Start/End: Complemental strand, 22736 - 22365
Alignment:
| Q |
15 |
gaatcatgaacaattcgtaatggagcaccatttaaatatgttctaggatcttatgaagatggaaagaaaagaatcgactattaccaaactcactcacaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22736 |
gaatcatgaacaattcgtaatggagcaccatttaaatatgttctaggatcttatgaagatggaaagaaaagaatcgactattaccaaactcactcacaca |
22637 |
T |
|
| Q |
115 |
aatgaaatcattgtggaattttggcaacgtaagagtgagatcaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaa |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22636 |
a------tcattgtggaattttggcaacgtaagagtgagatcaaagtattctagagtttattcacttgggaaaggcataggtataagattactataacaa |
22543 |
T |
|
| Q |
215 |
gatttaaattaagaggggaaaccgcgtttggtatgaattatacaaagcatgagaaaagaaaagatggtgtaggtgcagaaatatcttcattccattctat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22542 |
gatttaaattaagaggggaaaccgcgtttggtatgaattatacaaagcatgagaaaagaaaagatggtgtaggtgcagaaatatcttcattccagtctat |
22443 |
T |
|
| Q |
315 |
tagaaaaatatttatattgtcttgtaaatttaatttagttggtataagtattgcatattatatgtagaggttggattt |
392 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22442 |
tagaaaaatatttatactgtcttgtgaatttaatttagttggtatgagtattgcatattatatgtagaggttggattt |
22365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 70 - 169
Target Start/End: Complemental strand, 12839 - 12745
Alignment:
| Q |
70 |
aagatggaaagaaaagaatcgactattaccaaactcactcacacaaatgaaatcattgtggaattttggcaacgtaagagtgagatcaaagtattctaga |
169 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12839 |
aagatggaaagaaaagaatcgaccattaccaaactcactcaaacaaag-----cattgtggaattttggcaacgtaggagtgagatcaaagtattctaga |
12745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University