View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19022_high_10 (Length: 251)
Name: NF19022_high_10
Description: NF19022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19022_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 39248530 - 39248764
Alignment:
| Q |
1 |
ttgggcctagggcggttgccctcttcgccctgcctaagatgcagccctctacataac-atctagtgtatcaacaaagaaaaccaatgattatttaaccat |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
39248530 |
ttgggcctagggcggtcgccctcttcgccctgcctaagatacagccctctgcataaccatctagtgtatcaacagagaaaaccaatgattatataaccat |
39248629 |
T |
 |
| Q |
100 |
gacttaatgcaacaaaaaccacagattgaaacaaattttgttctaatcaaccactcattaattccctaccatatccaatccatttcctctactcatacgt |
199 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39248630 |
gacttaatacaacaaaaaccacagattgaaacaaattttgttctagtcaaccactcattaattccctaccatatccaatccatttcctctactcatacgt |
39248729 |
T |
 |
| Q |
200 |
ggcaaacacaaatagatatgaatgaaatcaataac |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39248730 |
ggcaaacacaaatagatatgaatgaaatcaataac |
39248764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 40
Target Start/End: Complemental strand, 35664459 - 35664422
Alignment:
| Q |
3 |
gggcctagggcggttgccctcttcgccctgcctaagat |
40 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
35664459 |
gggcctagggcggtcgccctcttcgccctgcctcagat |
35664422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University