View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19024_high_8 (Length: 406)
Name: NF19024_high_8
Description: NF19024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19024_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 6e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 15 - 180
Target Start/End: Original strand, 6635711 - 6635876
Alignment:
| Q |
15 |
cagagaggattgcagccatggatcctcggatatatgtcgtgtctaatgtcattgccacatggactgcttcctcggagcagatatatgtgtcagtgtcatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6635711 |
cagagaggattgcagccatggatcctcggatatatgttgtgtctaatgtcattgccacatggactgcttcctcggagcagatatatgtgccagtgtcatg |
6635810 |
T |
|
| Q |
115 |
ttcggtgtcttcttctggctcagtgatggaggcacaatttggtgagttgtagaattgaggggcttc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635811 |
ttcggtgtcttcttctggctcagtgatggaggcacaatttggtgagttgtagaattgaggggcttc |
6635876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 235 - 389
Target Start/End: Original strand, 6635931 - 6636085
Alignment:
| Q |
235 |
ggtggaggaggatagagattgaagacacaagagggagagaatgagaaagaaaaataagagttttggtttaggaaaattgaacttcannnnnnnnnnnnnn |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635931 |
ggtggaggaggatagagattgaagacacaagagggagagaatgagaaagaaaaataagagttttggtttaggaaaattgaacttcattttttatttttat |
6636030 |
T |
|
| Q |
335 |
nnnngattgaaaagagtgagatcttggaggtggcttatagttggagtttgagggt |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6636031 |
ttttgattgaaaagagtgagatcttggaggtggcttatagttggagtttgagggt |
6636085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 52164610 - 52164667
Alignment:
| Q |
22 |
gattgcagccatggatcctcggatatatgtcgtgtctaatgtcattgccacatggact |
79 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||| | ||||||||| || |||||| |
|
|
| T |
52164610 |
gattgctgccatggatcctcggatatatgttgtgtcgagtgtcattgctacttggact |
52164667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University