View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_high_38 (Length: 236)
Name: NF19025_high_38
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29464473 - 29464694
Alignment:
| Q |
1 |
catattagcatcatcattaatcacaagataaaaaaggagtaacaaagtttaatcaataatacaattatccatatgcaatttgctagttgatacataactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29464473 |
catattagcatcatcattaatcacaagataaaaaaggagtaacaaagtttaatcaataatacaattatccatatgcaatttgctagttgatacataactt |
29464572 |
T |
 |
| Q |
101 |
ttcaggcttaatctaaatgtccaaatgctgttgcaggtagacttgcaaaaaatgtggtaatgacaggaaatgtttttctcaatgggaagnnnnnnnctcc |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29464573 |
ttcagggctaatctaaatgtccaaatgctgttgcaggtagacttgcaaaaaatgtggtaatgacaggaaatgtttttctcaatgggaagaaaaaaactcc |
29464672 |
T |
 |
| Q |
201 |
aggctatggttttgttgtaagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29464673 |
aggctatggttttgttgtaagt |
29464694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 130 - 189
Target Start/End: Original strand, 29432513 - 29432572
Alignment:
| Q |
130 |
gttgcaggtagacttgcaaaaaatgtggtaatgacaggaaatgtttttctcaatgggaag |
189 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
29432513 |
gttgcaggtagacttccaaaaaatgtggtgatgacgggaaatgttcttctcaatgggaag |
29432572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University