View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_high_40 (Length: 230)
Name: NF19025_high_40
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 213
Target Start/End: Complemental strand, 48528221 - 48528018
Alignment:
| Q |
10 |
tcgaagaatataaaaatattgtttagcatatttgattttcagttgggaaaatctcaaatcatgttataaaatgggacgcggccatataaggatagatgtt |
109 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48528221 |
tcgaagaaaataaaaatattgtttagcatatttgattttcagttgggaaaatctcaaatcatgttataaaatgggacgcggccatataaggatagatgtt |
48528122 |
T |
 |
| Q |
110 |
tattttaggtgatataataagaaccattcacttcataaaaaacaaattattgttttgtttgtttattttaggtgattttaaaattaaaacaagagggttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48528121 |
tattttaggtgatataataagaaccattcacttcataaaaaacaaattattgttttgtttgtttattttaggtgattttaaaattaaaacaagagggttt |
48528022 |
T |
 |
| Q |
210 |
atgt |
213 |
Q |
| |
|
|||| |
|
|
| T |
48528021 |
atgt |
48528018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University