View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_high_43 (Length: 223)
Name: NF19025_high_43
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 2667014 - 2667201
Alignment:
| Q |
17 |
caaaggataaaacccaagacacaactggtcaagcaagagacaagggttatgaaatgggccaggctacaaaagaaactgcccaatcaggaaaggacaactc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2667014 |
caaaggataaaacccaagacacaactggtcaagcaagagacaagggttatgaaatgggccaggctacaaaagaaactgcccaatcaggaaaggacaactc |
2667113 |
T |
 |
| Q |
117 |
agctgggtttttgcaacagacaggtgagaaggttaagggtatggcacaaggtgcaactgaagcagttaagaacactttaggaatgaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2667114 |
agctgggtttttgcaacagacaggtgagaaggttaagggtatggcacaaggtgcaactgaagcagttaagaacactttaggaatgaat |
2667201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 2676032 - 2676219
Alignment:
| Q |
17 |
caaaggataaaacccaagacacaactggtcaagcaagagacaagggttatgaaatgggccaggctacaaaagaaactgcccaatcaggaaaggacaactc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2676032 |
caaaggataaaacccaagacacaactggtcaagcaagagacaagggttatgaaatgggccaggctacaaaagaaactgcccaatcaggaaaggacaactc |
2676131 |
T |
 |
| Q |
117 |
agctgggtttttgcaacagacaggtgagaaggttaagggtatggcacaaggtgcaactgaagcagttaagaacactttaggaatgaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2676132 |
agctgggtttttgcaacagacaggtgagaaggttaagggtatggcacaaggtgcaactgaagcagttaagaacactttaggaatgaat |
2676219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 2682060 - 2682244
Alignment:
| Q |
17 |
caaaggataaaacccaagacacaactggtcaagcaagagacaagggttatgaaatgggccaggctacaaaagaaactgcccaatcaggaaaggacaactc |
116 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| ||||| || || | || || |||||| | || ||||||||||||||||||||||| |||||||| |
|
|
| T |
2682060 |
caaaggaaaaagcccaagacacaactggtcaagctagagaaaaaggatcggagattggccagtcaaccaaagaaactgcccaatcaggaaaagacaactc |
2682159 |
T |
 |
| Q |
117 |
agctgggtttttgcaacagacaggtgagaaggttaagggtatggcacaaggtgcaactgaagcagttaagaacactttaggaatg |
201 |
Q |
| |
|
||| ||||| || || |||||||| || ||||||||||||||||| ||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2682160 |
agcagggttcttacagcagacaggagaaaaggttaagggtatggcccaaagtgctactgaagcagttaagaacacttttggaatg |
2682244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University