View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_high_44 (Length: 218)
Name: NF19025_high_44
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_high_44 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 218
Target Start/End: Complemental strand, 46245555 - 46245349
Alignment:
| Q |
11 |
atcatcacttttaaagagtatagttagacannnnnnnatttattttcttcatattttaacttagtcatatttgttctttaggtaaggaaaatgtctcaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46245555 |
atcatcacttttaaagagtatagttagacatttttt-atttattttcttcatattttaactcagtcatatttgttctttaggtaaggaaaatgtctcaga |
46245457 |
T |
 |
| Q |
111 |
tgtaagattagaggtgttgaaagaattgccacgtctgcaacagagagatcaatcaagaggaggtagatttggtgatggtggtggacgtggtgggggtagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46245456 |
tgtaagattagaggtgttgaaagaattgccacgtctgcaacagagagatcaatcaagaggtggtagatttggtgatggtggtggtcgtggtgggggtagt |
46245357 |
T |
 |
| Q |
211 |
aggttttc |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
46245356 |
aggttttc |
46245349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 75 - 218
Target Start/End: Complemental strand, 46255180 - 46255037
Alignment:
| Q |
75 |
tcatatttgttctttaggtaaggaaaatgtctcagatgtaagattagaggtgttgaaagaattgccacgtctgcaacagagagatcaatcaagaggaggt |
174 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| | | |
|
|
| T |
46255180 |
tcatatttgttcttcaggtaaggaagatgcttcatatgtaagattaaaggtgttgaaagaattgccgcgtctgcaacagagagatcaatcaagaggggtt |
46255081 |
T |
 |
| Q |
175 |
agatttggtgatggtggtggacgtggtgggggtagtaggttttc |
218 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
46255080 |
agatttggtgatggtagtggccgtggtggcggtagtaggttttc |
46255037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 91 - 218
Target Start/End: Complemental strand, 12370350 - 12370223
Alignment:
| Q |
91 |
ggtaaggaaaatgtctcagatgtaagattagaggtgttgaaagaattgccacgtctgcaacagagagatcaatcaagaggaggtagatttggtgatggtg |
190 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| |||| ||||||||| | ||| |||||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
12370350 |
ggtaaggaaaatgcctctgatgtaagattagagatgttaaaagaattgtcgcgtttgcaaccgagagatcaattgagagggggtagatttggtgatggta |
12370251 |
T |
 |
| Q |
191 |
gtggacgtggtgggggtagtaggttttc |
218 |
Q |
| |
|
| || || ||||||| |||||||||||| |
|
|
| T |
12370250 |
gcggtcgcggtggggttagtaggttttc |
12370223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University