View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_low_11 (Length: 442)
Name: NF19025_low_11
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 95 - 425
Target Start/End: Original strand, 54608157 - 54608487
Alignment:
| Q |
95 |
gcttagcattgaaaaactattttttatttgttactctttttgtaaattgcacctataaatgattttgatttgttctcattgctttagagattgatatgat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54608157 |
gcttagcattgaaaaactattttttatttgttactctttttgtaaattgcacctataaatgattttgatttgttctcattgctttagagatcgatatgat |
54608256 |
T |
 |
| Q |
195 |
gttaataattttagcattggttcatgttcatggttttgattattacatgacaaaattgcaaatgaattccataatattgatgaatgcaatcactttactt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54608257 |
gttaataattttagcattggttcatgttcatggttttgattattacatgacaaaattgcaaatgaatgccataatattgatgaatgcaatcactttactt |
54608356 |
T |
 |
| Q |
295 |
tcatatgtgctttgcaaattattttattcttgcgttcaactgtattaaggtgtggcgaaatgatatgggttgaggcgctaaagcagttttaagatggaaa |
394 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54608357 |
tcatatgtgctttgcgaataattttattcttgcgttcaactgtattaaggtgtggcgaaatgatatgggttgaggcgctaaagcagttttaagatggaaa |
54608456 |
T |
 |
| Q |
395 |
tacaaaattcgatccctcgtgctaacaaatt |
425 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
54608457 |
tacaaaattcgatccctagtgctaacaaatt |
54608487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 2 - 53
Target Start/End: Original strand, 54607871 - 54607922
Alignment:
| Q |
2 |
tacggtttaatattattcttctcaactcttcctcatgtaattttctcacctc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54607871 |
tacggtttaatattattcttctcaactcttcctcatgtaattttctcacctc |
54607922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University