View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_low_27 (Length: 340)
Name: NF19025_low_27
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 5 - 307
Target Start/End: Original strand, 32724768 - 32725075
Alignment:
| Q |
5 |
gactgagatgaaaaagcaacttaatttattattttgagtgttca-----tttcactagtgtatgttctatgtaatataggtctaggttttattgtatcta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724768 |
gactgagatgaaaaagcaacttaatttattattttgagtgttcatttcatttcactagtgtatgttctatgtaatataggtctaggttttattgtatcta |
32724867 |
T |
 |
| Q |
100 |
ggagcagctagtgaatttgtaacaattcaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttggacgtattactggtt |
199 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32724868 |
ggagcagctgttgaatttgtaacaattgaactaatgttgccagttttcaatctatttccatgttcaaattgatgagtattttttgcacgtattactggtt |
32724967 |
T |
 |
| Q |
200 |
tatgcggacagcatgattttcattagacacattgtcatttgttttgaggattgatacttcaaaatgctcttttattaaatgcccctattgtaattgcata |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32724968 |
tatgcggacagcatgattttcattagacacattgtcatttgttttgaggattgatacttcaaaatgctcttttattaaatgcccctattgtaattgcata |
32725067 |
T |
 |
| Q |
300 |
gatgttcc |
307 |
Q |
| |
|
| |||||| |
|
|
| T |
32725068 |
gttgttcc |
32725075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University