View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_low_33 (Length: 288)
Name: NF19025_low_33
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_low_33 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 16 - 288
Target Start/End: Complemental strand, 46930868 - 46930596
Alignment:
| Q |
16 |
agaatcaactcaacttaacatagtacatgcagtaagacccggtctttgtcaccaaataaaataaaataaacacatgcatggtcttatcattttcttgtct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46930868 |
agaatcaactcaacttaacatagtacatgcagtaagacccggtctttgtcaccaaataaaataaaataaacacatgcatggtcttatcattttcctgtct |
46930769 |
T |
|
| Q |
116 |
tcaacctattttttataagtacagtattaaatatgaatattcttgatgagtataatggttaattgtggccgtcgactatcaactatgctacaatatatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46930768 |
tcaacctattttttataagtacagtattaaatatgaatattcttgatgagtataatggttaattgtggccgtcgactatcaactatgctacaatatatta |
46930669 |
T |
|
| Q |
216 |
gagttgtttataaacatacatgcaaatcaattcagtttggtatgaggtgctaaaacgacgtgaaaatgcatcc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46930668 |
gagttgtttataaacatacatgcaaatcaattcagtttggtatgaggtggtaaaacgacgtgaaaatgcatcc |
46930596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University