View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19025_low_39 (Length: 238)

Name: NF19025_low_39
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19025_low_39
NF19025_low_39
[»] chr4 (1 HSPs)
chr4 (170-221)||(4880345-4880396)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 170 - 221
Target Start/End: Complemental strand, 4880396 - 4880345
Alignment:
170 aaagaatacaatcatagactatttgaccaactattgttccaacacaaaccaa 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
4880396 aaagaatacaatcatagactatttgaccaactattgttccaacacaaaccaa 4880345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University