View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_low_41 (Length: 236)
Name: NF19025_low_41
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_low_41 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 43362931 - 43363163
Alignment:
| Q |
16 |
gtttctgaattgatagaagaattcgttaagcaattaagtcaatatg------------ttaaatagattatcaaagaatacaacaaaaagtgttataact |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43362931 |
gtttctgaattgatagaagaattcgttaagcaattaagtcaatatgtggttagttatgttaaatagattatcaaagaatacaacaaaaagtgttataact |
43363030 |
T |
|
| Q |
104 |
cattagtgatcgaagaaatataatttaccatgactttgaacgttattaactacaatttgcaagtgtgtatttgtactcaagattgtggtaatgaatatca |
203 |
Q |
| |
|
||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43363031 |
cattagtcatcgacgaaatataatttacaatgactttgaacgttattaactacaatttgcaagtgtgtatttgtactcaagatcgtggtaatgaatatca |
43363130 |
T |
|
| Q |
204 |
tctgaatttaaagtttgaacacctggagatcac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43363131 |
tctgaatttaaagtttgaacacctggagatcac |
43363163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University