View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_low_44 (Length: 228)
Name: NF19025_low_44
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 212
Target Start/End: Original strand, 1549700 - 1549901
Alignment:
| Q |
11 |
agagtgtgtttattgagaaagaggagaataagaagaagaagaagggttcaagttcaagtactagtctaattggagggaaacaaatgcttatattgtgtgg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1549700 |
agagtgtgtttattgagaaagaggagaataagaagaagaagaagggttcaagttcaagtactagtgtaattggagggaaacaaatgcttatattgtgtgg |
1549799 |
T |
 |
| Q |
111 |
atttggttattggttacaagggtttagatgttttccttggcttgctcttaattttcatatggctagtaatctcaatttggacccttcaatattgcaactt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1549800 |
atttggttattggttacaagggtttagatgttttccttggcttgctcttaattttcatatggctagtaatctcaatttggacccttcaatattgcaactt |
1549899 |
T |
 |
| Q |
211 |
gt |
212 |
Q |
| |
|
|| |
|
|
| T |
1549900 |
gt |
1549901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University