View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19025_low_49 (Length: 212)
Name: NF19025_low_49
Description: NF19025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19025_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 52 - 175
Target Start/End: Complemental strand, 19885640 - 19885517
Alignment:
| Q |
52 |
ctgttgggcaatttttatatcagcacctatcacactagcctaattttggcaggttgtctaaatatgaataccgacacagaatcactaaattaaagtaatt |
151 |
Q |
| |
|
||||| ||| |||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
19885640 |
ctgttaggcgatttttatattagcaactattacactagcctaattttggcaggttgtctaaatatgaatactgtcacagaatcactcaattaaagtaatt |
19885541 |
T |
|
| Q |
152 |
ttactggatggatttactttcctt |
175 |
Q |
| |
|
|||| ||| | ||||||||||| |
|
|
| T |
19885540 |
ttaccaaatgcaattactttcctt |
19885517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 14751323 - 14751370
Alignment:
| Q |
5 |
tgaatgactaatatacaagtagtgtatgcatattgttgctagtatctc |
52 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14751323 |
tgaaggactaatataaaagtagtgtatgcatattgttgctagtatctc |
14751370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 93
Target Start/End: Original strand, 14751411 - 14751449
Alignment:
| Q |
55 |
ttgggcaatttttatatcagcacctatcacactagccta |
93 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
14751411 |
ttgggcgatttttatatcagcaactatcacactagccta |
14751449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University