View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19026_high_20 (Length: 304)
Name: NF19026_high_20
Description: NF19026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19026_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 86 - 288
Target Start/End: Original strand, 29905002 - 29905206
Alignment:
| Q |
86 |
taaccatgtggtttttatctgaatagttcattattgtccactcttcaccaagatcatccttgtgatcttccagaaaaattggattaaccacgccaaattc |
185 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29905002 |
taaccatgtggcttttatctaaatagttcattattgtccactcttcaccaagatcatccttgtgatcttccagaaaaattggattaaccacgccaaattc |
29905101 |
T |
 |
| Q |
186 |
ctt-nnnnnnnngtttgcaatgcataaggtgacataaaaccaaaacaatacttaaagaacaac-aataaatacttaccttgctgccaagataaagagtag |
283 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29905102 |
cttaaaaaaaaagtttgcaatgcataaggtgacataaaaccaaaacaatacttaaagaacaacaaataaatacttaccttgctgccaagataaagagtag |
29905201 |
T |
 |
| Q |
284 |
taaaa |
288 |
Q |
| |
|
||||| |
|
|
| T |
29905202 |
taaaa |
29905206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 12 - 42
Target Start/End: Original strand, 29904958 - 29904988
Alignment:
| Q |
12 |
atgaaaaccaaatacatcatgcatctctttc |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29904958 |
atgaaaaccaaatacatcatgcatctctttc |
29904988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University