View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19026_high_32 (Length: 209)
Name: NF19026_high_32
Description: NF19026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19026_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 3308235 - 3308059
Alignment:
| Q |
1 |
gagtgaaagagagagtgaatatggatatgattcaagtgttgagtgaagttgataatcattttataatggcttctgaagctgctcgcggtgtttctgtgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308235 |
gagtgaaagagagagtgaatatggatatgattcaagtgttgagtgaagttgataatcattttataatggcttctgaagctgctcgcggtgtttctgtgat |
3308136 |
T |
|
| Q |
101 |
tcttcaggctactcgtcttcactttcattcaaatttttctgatactgctagaggtaaccacaaaaatccatgttcat |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308135 |
tcttcaggctactcgtcttcactttcattcaaatttttctgatactgctagaggtaaccacaaaaatccatgttcat |
3308059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University